Isolation and Identification of Symbiotic Bacterium Associated With the Entomopathogenic Nematode, Heterorhabditis sp. (IISR-EPN 01) From India

Abstract

The symbiotic bacterium isolated from entomopathogenic nematode, Heterorhabditis sp. (IISR-EPN 01) from Kozhikode (Kerala), India and identified through morphological, biochemical and molecular characterization. The morphological characteristics and various biochemical tests were done as per described procedures. DNA was extracted from bacterial isolate (IISR-EPN BC 09). The primers 16 S 5' AGAGTTIGATCCTGGCTCAG 3' (FORWARD) and 5' AAGGAGGTGATCCAGCCGCA 3' (REVERSE) were used for the amplification of the ITS region of the rDNA and purified DNA was sequenced. The phylogenetic relationship were also studied using neighbor-joining and maximum composite likelihood methods. The bacterial isolate was Gram negative, rod shaped, facultative and motile. While, the colony characters were red colour with off white margins, circular, raised and opaque. Biochemical characterization showed that the isolate was positive for citrate utilization, methyl red, urease and carbohydrate fermentation tests and negative for indole production, oxidase and Voges Proskauer t ests. However, escullin showed weak reaction. On the basis of morphological, biochemical and molecular characterization, the bacterial isolate was identified as Photorhabdus fuminescens subsp. akhrustii. This symbiotic bacterium associated with Heterorhabditis sp. (IISR-EPN 01) which isolated from ginger rhizosphere from India for the first time. The identification of the symbiotic bacteria would help in a better understanding of the relationship between these two organisms